CSPI02G02260 (gene) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGCCTTCAAAATTTTTGTGAATGGAGGCTATTGGTTCACCCACACCAATACCCACTTTCCCATTTCAAAAATTGATACCAATCTTTTCACTCATCTCTTCTGTGGTGGTTGTGTTAGTATCAACCTCCAAACTTATGAACTCTCCATTTCAAATTCCACAAAACCCCTAATTGACCAATTTTCCAAAGCCATCAAAGAGAAAAATCACGAGGTAAAAACTTTGTTGTCCATCAACGAATCAGAAGATGATGCAAAAGGTGATCATGGAAGATTTGCAGCCATGGCTAGGGACTCTTCGAACCGAACCGTGCGACGTTCATTTGATCTTTAA ATGGCCTTCAAAATTTTTGTGAATGGAGGCTATTGGTTCACCCACACCAATACCCACTTTCCCATTTCAAAAATTGATACCAATCTTTTCACTCATCTCTTCTGTGGTGGTTGTGTTAGTATCAACCTCCAAACTTATGAACTCTCCATTTCAAATTCCACAAAACCCCTAATTGACCAATTTTCCAAAGCCATCAAAGAGAAAAATCACGAGGTAAAAACTTTGTTGTCCATCAACGAATCAGAAGATGATGCAAAAGGTGATCATGGAAGATTTGCAGCCATGGCTAGGGACTCTTCGAACCGAACCGTGCGACGTTCATTTGATCTTTAA ATGGCCTTCAAAATTTTTGTGAATGGAGGCTATTGGTTCACCCACACCAATACCCACTTTCCCATTTCAAAAATTGATACCAATCTTTTCACTCATCTCTTCTGTGGTGGTTGTGTTAGTATCAACCTCCAAACTTATGAACTCTCCATTTCAAATTCCACAAAACCCCTAATTGACCAATTTTCCAAAGCCATCAAAGAGAAAAATCACGAGGTAAAAACTTTGTTGTCCATCAACGAATCAGAAGATGATGCAAAAGGTGATCATGGAAGATTTGCAGCCATGGCTAGGGACTCTTCGAACCGAACCGTGCGACGTTCATTTGATCTTTAA
BLAST of CSPI02G02260 vs. TrEMBL
Match: A0A0A0LL51_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G008760 PE=4 SV=1) HSP 1 Score: 206.8 bits (525), Expect = 1.3e-50 Identity = 101/102 (99.02%), Postives = 101/102 (99.02%), Query Frame = 1
BLAST of CSPI02G02260 vs. TrEMBL
Match: R0F524_9BRAS (Uncharacterized protein OS=Capsella rubella GN=CARUB_v10005092mg PE=3 SV=1) HSP 1 Score: 74.3 bits (181), Expect = 1.0e-10 Identity = 41/96 (42.71%), Postives = 61/96 (63.54%), Query Frame = 1
BLAST of CSPI02G02260 vs. TrEMBL
Match: B9HAQ4_POPTR (Class V chitinase family protein OS=Populus trichocarpa GN=POPTR_0006s20260g PE=4 SV=1) HSP 1 Score: 72.4 bits (176), Expect = 3.9e-10 Identity = 42/96 (43.75%), Postives = 57/96 (59.38%), Query Frame = 1
BLAST of CSPI02G02260 vs. TrEMBL
Match: H6WS86_POPCA (Chitinase 2 OS=Populus canadensis PE=2 SV=1) HSP 1 Score: 72.4 bits (176), Expect = 3.9e-10 Identity = 42/96 (43.75%), Postives = 58/96 (60.42%), Query Frame = 1
BLAST of CSPI02G02260 vs. TrEMBL
Match: A0A067KHH4_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_09020 PE=4 SV=1) HSP 1 Score: 71.6 bits (174), Expect = 6.7e-10 Identity = 40/96 (41.67%), Postives = 58/96 (60.42%), Query Frame = 1
BLAST of CSPI02G02260 vs. TAIR10
Match: AT4G19810.1 (AT4G19810.1 Glycosyl hydrolase family protein with chitinase insertion domain) HSP 1 Score: 65.5 bits (158), Expect = 2.4e-11 Identity = 39/102 (38.24%), Postives = 60/102 (58.82%), Query Frame = 1
BLAST of CSPI02G02260 vs. TAIR10
Match: AT4G19820.1 (AT4G19820.1 Glycosyl hydrolase family protein with chitinase insertion domain) HSP 1 Score: 65.1 bits (157), Expect = 3.2e-11 Identity = 39/102 (38.24%), Postives = 57/102 (55.88%), Query Frame = 1
BLAST of CSPI02G02260 vs. TAIR10
Match: AT4G19750.1 (AT4G19750.1 Glycosyl hydrolase family protein with chitinase insertion domain) HSP 1 Score: 60.8 bits (146), Expect = 5.9e-10 Identity = 34/96 (35.42%), Postives = 50/96 (52.08%), Query Frame = 1
BLAST of CSPI02G02260 vs. TAIR10
Match: AT4G19800.1 (AT4G19800.1 Glycosyl hydrolase family protein with chitinase insertion domain) HSP 1 Score: 58.9 bits (141), Expect = 2.3e-09 Identity = 38/110 (34.55%), Postives = 59/110 (53.64%), Query Frame = 1
BLAST of CSPI02G02260 vs. TAIR10
Match: AT4G19760.1 (AT4G19760.1 Glycosyl hydrolase family protein with chitinase insertion domain) HSP 1 Score: 56.2 bits (134), Expect = 1.5e-08 Identity = 37/104 (35.58%), Postives = 53/104 (50.96%), Query Frame = 1
BLAST of CSPI02G02260 vs. NCBI nr
Match: gi|449443267|ref|XP_004139401.1| (PREDICTED: chitotriosidase-1 [Cucumis sativus]) HSP 1 Score: 206.8 bits (525), Expect = 1.9e-50 Identity = 101/102 (99.02%), Postives = 101/102 (99.02%), Query Frame = 1
BLAST of CSPI02G02260 vs. NCBI nr
Match: gi|565443971|ref|XP_006283969.1| (hypothetical protein CARUB_v10005092mg [Capsella rubella]) HSP 1 Score: 74.3 bits (181), Expect = 1.5e-10 Identity = 41/96 (42.71%), Postives = 61/96 (63.54%), Query Frame = 1
BLAST of CSPI02G02260 vs. NCBI nr
Match: gi|729308553|ref|XP_010529289.1| (PREDICTED: LOW QUALITY PROTEIN: chitotriosidase-1 [Tarenaya hassleriana]) HSP 1 Score: 73.9 bits (180), Expect = 1.9e-10 Identity = 43/102 (42.16%), Postives = 61/102 (59.80%), Query Frame = 1
BLAST of CSPI02G02260 vs. NCBI nr
Match: gi|224091669|ref|XP_002309324.1| (class V chitinase family protein [Populus trichocarpa]) HSP 1 Score: 72.4 bits (176), Expect = 5.6e-10 Identity = 42/96 (43.75%), Postives = 57/96 (59.38%), Query Frame = 1
BLAST of CSPI02G02260 vs. NCBI nr
Match: gi|374719231|gb|AEZ67301.1| (chitinase 2 [Populus x canadensis]) HSP 1 Score: 72.4 bits (176), Expect = 5.6e-10 Identity = 42/96 (43.75%), Postives = 58/96 (60.42%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (PI183967)
Date Performed: 2017-01-17
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |