CSPI01G33740 (gene) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGTTTGGTGAAGTTGAGGTTTCTACAGAAGTTTTGACAAACAATGTACTTGGATGTCGAACTCCTCCTTTCCATGCTCCAGGGCGTATTCCCTTCTATGTGACACGCTACAATAGGCTAGCCTGCAGTGAGGTTAGAGAGTTTGAATATCGTGAGAAGCCACCAACCCTTTCAGTATCTAATGCCCCCAAGTGTGCACCATAA ATGTTTGGTGAAGTTGAGGTTTCTACAGAAGTTTTGACAAACAATGTACTTGGATGTCGAACTCCTCCTTTCCATGCTCCAGGGCGTATTCCCTTCTATGTGACACGCTACAATAGGCTAGCCTGCAGTGAGGTTAGAGAGTTTGAATATCGTGAGAAGCCACCAACCCTTTCAGTATCTAATGCCCCCAAGTGTGCACCATAA ATGTTTGGTGAAGTTGAGGTTTCTACAGAAGTTTTGACAAACAATGTACTTGGATGTCGAACTCCTCCTTTCCATGCTCCAGGGCGTATTCCCTTCTATGTGACACGCTACAATAGGCTAGCCTGCAGTGAGGTTAGAGAGTTTGAATATCGTGAGAAGCCACCAACCCTTTCAGTATCTAATGCCCCCAAGTGTGCACCATAA
BLAST of CSPI01G33740 vs. Swiss-Prot
Match: CMTA3_ARATH (Calmodulin-binding transcription activator 3 OS=Arabidopsis thaliana GN=CMTA3 PE=1 SV=1) HSP 1 Score: 70.9 bits (172), Expect = 6.2e-12 Identity = 31/51 (60.78%), Postives = 38/51 (74.51%), Query Frame = 1
BLAST of CSPI01G33740 vs. Swiss-Prot
Match: CMTA1_ARATH (Calmodulin-binding transcription activator 1 OS=Arabidopsis thaliana GN=CMTA1 PE=2 SV=2) HSP 1 Score: 69.3 bits (168), Expect = 1.8e-11 Identity = 31/50 (62.00%), Postives = 36/50 (72.00%), Query Frame = 1
BLAST of CSPI01G33740 vs. Swiss-Prot
Match: CMTA2_ARATH (Calmodulin-binding transcription activator 2 OS=Arabidopsis thaliana GN=CMTA2 PE=1 SV=1) HSP 1 Score: 65.9 bits (159), Expect = 2.0e-10 Identity = 28/50 (56.00%), Postives = 37/50 (74.00%), Query Frame = 1
BLAST of CSPI01G33740 vs. Swiss-Prot
Match: CMTA4_ARATH (Calmodulin-binding transcription activator 4 OS=Arabidopsis thaliana GN=CMTA4 PE=1 SV=1) HSP 1 Score: 59.7 bits (143), Expect = 1.4e-08 Identity = 28/66 (42.42%), Postives = 38/66 (57.58%), Query Frame = 1
BLAST of CSPI01G33740 vs. TrEMBL
Match: A0A0A0KXF3_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G304810 PE=4 SV=1) HSP 1 Score: 122.9 bits (307), Expect = 1.5e-25 Identity = 57/67 (85.07%), Postives = 58/67 (86.57%), Query Frame = 1
BLAST of CSPI01G33740 vs. TrEMBL
Match: D7T677_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_05s0020g00630 PE=4 SV=1) HSP 1 Score: 98.2 bits (243), Expect = 4.1e-18 Identity = 46/67 (68.66%), Postives = 52/67 (77.61%), Query Frame = 1
BLAST of CSPI01G33740 vs. TrEMBL
Match: A0A0D2UVU6_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_011G204700 PE=4 SV=1) HSP 1 Score: 98.2 bits (243), Expect = 4.1e-18 Identity = 45/65 (69.23%), Postives = 50/65 (76.92%), Query Frame = 1
BLAST of CSPI01G33740 vs. TrEMBL
Match: A0A0D2UW74_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_011G204700 PE=4 SV=1) HSP 1 Score: 98.2 bits (243), Expect = 4.1e-18 Identity = 45/65 (69.23%), Postives = 50/65 (76.92%), Query Frame = 1
BLAST of CSPI01G33740 vs. TrEMBL
Match: A0A0D2UVU1_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_011G204700 PE=4 SV=1) HSP 1 Score: 98.2 bits (243), Expect = 4.1e-18 Identity = 45/65 (69.23%), Postives = 50/65 (76.92%), Query Frame = 1
BLAST of CSPI01G33740 vs. TAIR10
Match: AT2G22300.1 (AT2G22300.1 signal responsive 1) HSP 1 Score: 70.9 bits (172), Expect = 3.5e-13 Identity = 31/51 (60.78%), Postives = 38/51 (74.51%), Query Frame = 1
BLAST of CSPI01G33740 vs. TAIR10
Match: AT5G09410.3 (AT5G09410.3 ethylene induced calmodulin binding protein) HSP 1 Score: 69.3 bits (168), Expect = 1.0e-12 Identity = 31/50 (62.00%), Postives = 36/50 (72.00%), Query Frame = 1
BLAST of CSPI01G33740 vs. TAIR10
Match: AT5G64220.1 (AT5G64220.1 Calmodulin-binding transcription activator protein with CG-1 and Ankyrin domains) HSP 1 Score: 65.9 bits (159), Expect = 1.1e-11 Identity = 28/50 (56.00%), Postives = 37/50 (74.00%), Query Frame = 1
BLAST of CSPI01G33740 vs. TAIR10
Match: AT1G67310.1 (AT1G67310.1 Calmodulin-binding transcription activator protein with CG-1 and Ankyrin domains) HSP 1 Score: 59.7 bits (143), Expect = 8.1e-10 Identity = 28/66 (42.42%), Postives = 38/66 (57.58%), Query Frame = 1
BLAST of CSPI01G33740 vs. NCBI nr
Match: gi|659069234|ref|XP_008448822.1| (PREDICTED: calmodulin-binding transcription activator 3-like isoform X2 [Cucumis melo]) HSP 1 Score: 128.6 bits (322), Expect = 4.0e-27 Identity = 60/67 (89.55%), Postives = 60/67 (89.55%), Query Frame = 1
BLAST of CSPI01G33740 vs. NCBI nr
Match: gi|659069236|ref|XP_008448831.1| (PREDICTED: calmodulin-binding transcription activator 3-like isoform X3 [Cucumis melo]) HSP 1 Score: 128.6 bits (322), Expect = 4.0e-27 Identity = 60/67 (89.55%), Postives = 60/67 (89.55%), Query Frame = 1
BLAST of CSPI01G33740 vs. NCBI nr
Match: gi|659069238|ref|XP_008448838.1| (PREDICTED: calmodulin-binding transcription activator 3-like isoform X4 [Cucumis melo]) HSP 1 Score: 128.6 bits (322), Expect = 4.0e-27 Identity = 60/67 (89.55%), Postives = 60/67 (89.55%), Query Frame = 1
BLAST of CSPI01G33740 vs. NCBI nr
Match: gi|659069232|ref|XP_008448813.1| (PREDICTED: calmodulin-binding transcription activator 3-like isoform X1 [Cucumis melo]) HSP 1 Score: 128.6 bits (322), Expect = 4.0e-27 Identity = 60/67 (89.55%), Postives = 60/67 (89.55%), Query Frame = 1
BLAST of CSPI01G33740 vs. NCBI nr
Match: gi|778693657|ref|XP_011653672.1| (PREDICTED: calmodulin-binding transcription activator 3-like isoform X2 [Cucumis sativus]) HSP 1 Score: 122.9 bits (307), Expect = 2.2e-25 Identity = 57/67 (85.07%), Postives = 58/67 (86.57%), Query Frame = 1
The following BLAST results are available for this feature:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (PI183967)
Date Performed: 2017-01-17
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|