CSPI01G12700 (gene) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGAGGATACTGGAATGTTCCGAACATGGTCCAACGAAGAAGAGGGTAATTTTTTGAAACTGTCTAAGGCAAAGTATGATGCTCGACCTGCTAACATCAATTTTCGCCCTAACTACAATAGTAAAGTTCCAACATACACCGCACCAGAAGATGTATATCGATCTGCTAGAACAATGGGACCCGATAAGACAGAGAATAAGAGATATAATCTGACATGA ATGGAGGATACTGGAATGTTCCGAACATGGTCCAACGAAGAAGAGGGTAATTTTTTGAAACTGTCTAAGGCAAAGTATGATGCTCGACCTGCTAACATCAATTTTCGCCCTAACTACAATAGTAAAGTTCCAACATACACCGCACCAGAAGATGTATATCGATCTGCTAGAACAATGGGACCCGATAAGACAGAGAATAAGAGATATAATCTGACATGA ATGGAGGATACTGGAATGTTCCGAACATGGTCCAACGAAGAAGAGGGTAATTTTTTGAAACTGTCTAAGGCAAAGTATGATGCTCGACCTGCTAACATCAATTTTCGCCCTAACTACAATAGTAAAGTTCCAACATACACCGCACCAGAAGATGTATATCGATCTGCTAGAACAATGGGACCCGATAAGACAGAGAATAAGAGATATAATCTGACATGA
BLAST of CSPI01G12700 vs. TrEMBL
Match: A0A0A0KZI5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G129580 PE=3 SV=1) HSP 1 Score: 111.7 bits (278), Expect = 3.8e-22 Identity = 52/72 (72.22%), Postives = 59/72 (81.94%), Query Frame = 1
BLAST of CSPI01G12700 vs. TrEMBL
Match: A0A0A0KVY1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G129560 PE=4 SV=1) HSP 1 Score: 102.1 bits (253), Expect = 3.0e-19 Identity = 50/71 (70.42%), Postives = 57/71 (80.28%), Query Frame = 1
BLAST of CSPI01G12700 vs. TrEMBL
Match: A0A0A0KY65_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G129600 PE=3 SV=1) HSP 1 Score: 80.9 bits (198), Expect = 7.2e-13 Identity = 43/71 (60.56%), Postives = 53/71 (74.65%), Query Frame = 1
BLAST of CSPI01G12700 vs. TrEMBL
Match: A0A0A0L0X4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G129570 PE=4 SV=1) HSP 1 Score: 69.7 bits (169), Expect = 1.7e-09 Identity = 39/72 (54.17%), Postives = 48/72 (66.67%), Query Frame = 1
BLAST of CSPI01G12700 vs. TrEMBL
Match: A0A059ADR7_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_J01390 PE=3 SV=1) HSP 1 Score: 69.7 bits (169), Expect = 1.7e-09 Identity = 34/71 (47.89%), Postives = 44/71 (61.97%), Query Frame = 1
BLAST of CSPI01G12700 vs. TAIR10
Match: AT3G51550.1 (AT3G51550.1 Malectin/receptor-like protein kinase family protein) HSP 1 Score: 48.9 bits (115), Expect = 1.5e-06 Identity = 28/70 (40.00%), Postives = 37/70 (52.86%), Query Frame = 1
BLAST of CSPI01G12700 vs. TAIR10
Match: AT5G39000.1 (AT5G39000.1 Malectin/receptor-like protein kinase family protein) HSP 1 Score: 48.5 bits (114), Expect = 2.0e-06 Identity = 27/72 (37.50%), Postives = 43/72 (59.72%), Query Frame = 1
BLAST of CSPI01G12700 vs. TAIR10
Match: AT5G38990.1 (AT5G38990.1 Malectin/receptor-like protein kinase family protein) HSP 1 Score: 48.1 bits (113), Expect = 2.6e-06 Identity = 31/72 (43.06%), Postives = 39/72 (54.17%), Query Frame = 1
BLAST of CSPI01G12700 vs. NCBI nr
Match: gi|449438965|ref|XP_004137258.1| (PREDICTED: receptor-like protein kinase FERONIA [Cucumis sativus]) HSP 1 Score: 111.7 bits (278), Expect = 5.5e-22 Identity = 52/72 (72.22%), Postives = 59/72 (81.94%), Query Frame = 1
BLAST of CSPI01G12700 vs. NCBI nr
Match: gi|659129240|ref|XP_008464587.1| (PREDICTED: receptor-like protein kinase FERONIA [Cucumis melo]) HSP 1 Score: 109.8 bits (273), Expect = 2.1e-21 Identity = 53/72 (73.61%), Postives = 60/72 (83.33%), Query Frame = 1
BLAST of CSPI01G12700 vs. NCBI nr
Match: gi|778697577|ref|XP_011654352.1| (PREDICTED: receptor-like protein kinase FERONIA [Cucumis sativus]) HSP 1 Score: 102.1 bits (253), Expect = 4.3e-19 Identity = 50/71 (70.42%), Postives = 57/71 (80.28%), Query Frame = 1
BLAST of CSPI01G12700 vs. NCBI nr
Match: gi|700198632|gb|KGN53790.1| (hypothetical protein Csa_4G129560 [Cucumis sativus]) HSP 1 Score: 102.1 bits (253), Expect = 4.3e-19 Identity = 50/71 (70.42%), Postives = 57/71 (80.28%), Query Frame = 1
BLAST of CSPI01G12700 vs. NCBI nr
Match: gi|449438963|ref|XP_004137257.1| (PREDICTED: receptor-like protein kinase FERONIA [Cucumis sativus]) HSP 1 Score: 80.9 bits (198), Expect = 1.0e-12 Identity = 43/71 (60.56%), Postives = 53/71 (74.65%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (PI183967)
Date Performed: 2017-01-17
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |