CSPI01G11460 (gene) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGCCACTCTATGATTTTCTTGAGATAGAGACAGCCACAGATAATTTTTCTCCCTCTAGCAAGGTAGGTGAAGGTGGCTTCGGTCCTGGATTCAAGGTATTTCTTTTCACTTGCTAGTGTTCTTCAATCATTTCATAAACTTTAACTTTTCATTTTCATAAAAGACTTAAAAGTTTTGAATATACACGTACACATATATACTCAGTCACAATAAGACATGCTACACATTGCAGGGAAATCTTCCATCAGGACACGAAATTGCAGTAAAAAGACTGGCAGAGGGTTCTGGTCAAGGCCAAACTGAGTTCAAAAACGAGATCTTGTTAATATCTAAACTCCAACATAGAAATCTTCGTTAA ATGCCACTCTATGATTTTCTTGAGATAGAGACAGCCACAGATAATTTTTCTCCCTCTAGCAAGGTAGGTGAAGGTGGCTTCGGTCCTGGATTCAAGGGAAATCTTCCATCAGGACACGAAATTGCAGTAAAAAGACTGGCAGAGGGTTCTGGTCAAGGCCAAACTGAGTTCAAAAACGAGATCTTGTTAATATCTAAACTCCAACATAGAAATCTTCGTTAA ATGCCACTCTATGATTTTCTTGAGATAGAGACAGCCACAGATAATTTTTCTCCCTCTAGCAAGGTAGGTGAAGGTGGCTTCGGTCCTGGATTCAAGGGAAATCTTCCATCAGGACACGAAATTGCAGTAAAAAGACTGGCAGAGGGTTCTGGTCAAGGCCAAACTGAGTTCAAAAACGAGATCTTGTTAATATCTAAACTCCAACATAGAAATCTTCGTTAA
BLAST of CSPI01G11460 vs. Swiss-Prot
Match: CRK38_ARATH (Cysteine-rich receptor-like protein kinase 38 OS=Arabidopsis thaliana GN=CRK38 PE=3 SV=1) HSP 1 Score: 96.3 bits (238), Expect = 1.5e-19 Identity = 44/69 (63.77%), Postives = 56/69 (81.16%), Query Frame = 1
BLAST of CSPI01G11460 vs. Swiss-Prot
Match: CRK16_ARATH (Putative cysteine-rich receptor-like protein kinase 16 OS=Arabidopsis thaliana GN=CRK16 PE=3 SV=2) HSP 1 Score: 95.9 bits (237), Expect = 2.0e-19 Identity = 44/69 (63.77%), Postives = 56/69 (81.16%), Query Frame = 1
BLAST of CSPI01G11460 vs. Swiss-Prot
Match: Y1142_ARATH (G-type lectin S-receptor-like serine/threonine-protein kinase At1g61420 OS=Arabidopsis thaliana GN=At1g61420 PE=3 SV=2) HSP 1 Score: 95.1 bits (235), Expect = 3.4e-19 Identity = 45/72 (62.50%), Postives = 57/72 (79.17%), Query Frame = 1
BLAST of CSPI01G11460 vs. Swiss-Prot
Match: SD129_ARATH (G-type lectin S-receptor-like serine/threonine-protein kinase SD1-29 OS=Arabidopsis thaliana GN=SD129 PE=1 SV=1) HSP 1 Score: 94.7 bits (234), Expect = 4.4e-19 Identity = 46/69 (66.67%), Postives = 53/69 (76.81%), Query Frame = 1
BLAST of CSPI01G11460 vs. Swiss-Prot
Match: Y1133_ARATH (G-type lectin S-receptor-like serine/threonine-protein kinase At1g11330 OS=Arabidopsis thaliana GN=At1g11330 PE=2 SV=3) HSP 1 Score: 94.4 bits (233), Expect = 5.7e-19 Identity = 43/72 (59.72%), Postives = 57/72 (79.17%), Query Frame = 1
BLAST of CSPI01G11460 vs. TrEMBL
Match: A0A0A0LUE1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G071180 PE=4 SV=1) HSP 1 Score: 151.0 bits (380), Expect = 5.8e-34 Identity = 73/73 (100.00%), Postives = 73/73 (100.00%), Query Frame = 1
BLAST of CSPI01G11460 vs. TrEMBL
Match: A0A0D2UNZ7_GOSRA (Serine/threonine-protein kinase OS=Gossypium raimondii GN=B456_009G175100 PE=3 SV=1) HSP 1 Score: 112.1 bits (279), Expect = 3.0e-22 Identity = 50/72 (69.44%), Postives = 62/72 (86.11%), Query Frame = 1
BLAST of CSPI01G11460 vs. TrEMBL
Match: A0A061GH52_THECC (S-locus lectin protein kinase family protein isoform 2 OS=Theobroma cacao GN=TCM_030044 PE=4 SV=1) HSP 1 Score: 109.8 bits (273), Expect = 1.5e-21 Identity = 50/72 (69.44%), Postives = 61/72 (84.72%), Query Frame = 1
BLAST of CSPI01G11460 vs. TrEMBL
Match: A0A061GG11_THECC (Serine/threonine-protein kinase OS=Theobroma cacao GN=TCM_030044 PE=3 SV=1) HSP 1 Score: 109.8 bits (273), Expect = 1.5e-21 Identity = 50/72 (69.44%), Postives = 61/72 (84.72%), Query Frame = 1
BLAST of CSPI01G11460 vs. TrEMBL
Match: A0A0A0LS68_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G071170 PE=4 SV=1) HSP 1 Score: 107.8 bits (268), Expect = 5.6e-21 Identity = 52/72 (72.22%), Postives = 60/72 (83.33%), Query Frame = 1
BLAST of CSPI01G11460 vs. TAIR10
Match: AT4G04510.1 (AT4G04510.1 cysteine-rich RLK (RECEPTOR-like protein kinase) 38) HSP 1 Score: 96.3 bits (238), Expect = 8.5e-21 Identity = 44/69 (63.77%), Postives = 56/69 (81.16%), Query Frame = 1
BLAST of CSPI01G11460 vs. TAIR10
Match: AT1G61420.1 (AT1G61420.1 S-locus lectin protein kinase family protein) HSP 1 Score: 95.1 bits (235), Expect = 1.9e-20 Identity = 45/72 (62.50%), Postives = 57/72 (79.17%), Query Frame = 1
BLAST of CSPI01G11460 vs. TAIR10
Match: AT1G61380.1 (AT1G61380.1 S-domain-1 29) HSP 1 Score: 94.7 bits (234), Expect = 2.5e-20 Identity = 46/69 (66.67%), Postives = 53/69 (76.81%), Query Frame = 1
BLAST of CSPI01G11460 vs. TAIR10
Match: AT1G11330.2 (AT1G11330.2 S-locus lectin protein kinase family protein) HSP 1 Score: 94.4 bits (233), Expect = 3.2e-20 Identity = 43/72 (59.72%), Postives = 57/72 (79.17%), Query Frame = 1
BLAST of CSPI01G11460 vs. TAIR10
Match: AT4G04500.1 (AT4G04500.1 cysteine-rich RLK (RECEPTOR-like protein kinase) 37) HSP 1 Score: 94.0 bits (232), Expect = 4.2e-20 Identity = 45/69 (65.22%), Postives = 56/69 (81.16%), Query Frame = 1
BLAST of CSPI01G11460 vs. NCBI nr
Match: gi|700209508|gb|KGN64604.1| (hypothetical protein Csa_1G071180 [Cucumis sativus]) HSP 1 Score: 151.0 bits (380), Expect = 8.3e-34 Identity = 73/73 (100.00%), Postives = 73/73 (100.00%), Query Frame = 1
BLAST of CSPI01G11460 vs. NCBI nr
Match: gi|778658590|ref|XP_011652933.1| (PREDICTED: G-type lectin S-receptor-like serine/threonine-protein kinase At4g27290 isoform X2 [Cucumis sativus]) HSP 1 Score: 117.9 bits (294), Expect = 7.7e-24 Identity = 57/72 (79.17%), Postives = 64/72 (88.89%), Query Frame = 1
BLAST of CSPI01G11460 vs. NCBI nr
Match: gi|659068833|ref|XP_008446536.1| (PREDICTED: receptor-like serine/threonine-protein kinase SD1-8 [Cucumis melo]) HSP 1 Score: 117.9 bits (294), Expect = 7.7e-24 Identity = 57/72 (79.17%), Postives = 64/72 (88.89%), Query Frame = 1
BLAST of CSPI01G11460 vs. NCBI nr
Match: gi|778658587|ref|XP_011652927.1| (PREDICTED: G-type lectin S-receptor-like serine/threonine-protein kinase At4g27290 isoform X1 [Cucumis sativus]) HSP 1 Score: 117.9 bits (294), Expect = 7.7e-24 Identity = 57/72 (79.17%), Postives = 64/72 (88.89%), Query Frame = 1
BLAST of CSPI01G11460 vs. NCBI nr
Match: gi|659067899|ref|XP_008441808.1| (PREDICTED: G-type lectin S-receptor-like serine/threonine-protein kinase At4g27290 isoform X2 [Cucumis melo]) HSP 1 Score: 115.5 bits (288), Expect = 3.8e-23 Identity = 55/72 (76.39%), Postives = 63/72 (87.50%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (PI183967)
Date Performed: 2017-01-17
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |