CSPI01G11190 (gene) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGAGGGGTTCTTGCAGTTCAATTTCAACATCATTAAAATGGCAACAGATGAATTTTCAGATGAAAATAAACTTGGGGAAGGTGGATTTGGAGATTGTTACAAGGTAATAATTACTCATAAAGATGTTAGTTTTATGAGTTAGCCAGCGTGTGTGATGAATTCCTTTTTTCACTTCCATTAACAGGGGAAGCTTCCAAATGGACGAATCGTAGCGGTGAAACGGCTGCGTGAAGCGTCAAGACATTGGAGATGTTGA ATGGAGGGGTTCTTGCAGTTCAATTTCAACATCATTAAAATGGCAACAGATGAATTTTCAGATGAAAATAAACTTGGGGAAGGTGGATTTGGAGATTGTTACAAGGGGAAGCTTCCAAATGGACGAATCGTAGCGGTGAAACGGCTGCGTGAAGCGTCAAGACATTGGAGATGTTGA ATGGAGGGGTTCTTGCAGTTCAATTTCAACATCATTAAAATGGCAACAGATGAATTTTCAGATGAAAATAAACTTGGGGAAGGTGGATTTGGAGATTGTTACAAGGGGAAGCTTCCAAATGGACGAATCGTAGCGGTGAAACGGCTGCGTGAAGCGTCAAGACATTGGAGATGTTGA
BLAST of CSPI01G11190 vs. Swiss-Prot
Match: CRK5_ARATH (Cysteine-rich receptor-like protein kinase 5 OS=Arabidopsis thaliana GN=CRK5 PE=1 SV=1) HSP 1 Score: 69.3 bits (168), Expect = 1.6e-11 Identity = 33/51 (64.71%), Postives = 39/51 (76.47%), Query Frame = 1
BLAST of CSPI01G11190 vs. Swiss-Prot
Match: Y1675_ARATH (G-type lectin S-receptor-like serine/threonine-protein kinase At1g67520 OS=Arabidopsis thaliana GN=At1g67520 PE=2 SV=3) HSP 1 Score: 68.2 bits (165), Expect = 3.5e-11 Identity = 32/47 (68.09%), Postives = 36/47 (76.60%), Query Frame = 1
BLAST of CSPI01G11190 vs. Swiss-Prot
Match: CRK38_ARATH (Cysteine-rich receptor-like protein kinase 38 OS=Arabidopsis thaliana GN=CRK38 PE=3 SV=1) HSP 1 Score: 67.8 bits (164), Expect = 4.6e-11 Identity = 30/49 (61.22%), Postives = 37/49 (75.51%), Query Frame = 1
BLAST of CSPI01G11190 vs. Swiss-Prot
Match: CRK40_ARATH (Cysteine-rich receptor-like protein kinase 40 OS=Arabidopsis thaliana GN=CRK40 PE=2 SV=1) HSP 1 Score: 66.6 bits (161), Expect = 1.0e-10 Identity = 30/49 (61.22%), Postives = 37/49 (75.51%), Query Frame = 1
BLAST of CSPI01G11190 vs. Swiss-Prot
Match: CRK31_ARATH (Putative cysteine-rich receptor-like protein kinase 31 OS=Arabidopsis thaliana GN=CRK31 PE=3 SV=1) HSP 1 Score: 65.5 bits (158), Expect = 2.3e-10 Identity = 30/49 (61.22%), Postives = 36/49 (73.47%), Query Frame = 1
BLAST of CSPI01G11190 vs. TrEMBL
Match: A0A0A0LS47_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G065930 PE=4 SV=1) HSP 1 Score: 76.3 bits (186), Expect = 1.4e-11 Identity = 34/44 (77.27%), Postives = 39/44 (88.64%), Query Frame = 1
BLAST of CSPI01G11190 vs. TrEMBL
Match: A0A0A0LRP0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G064870 PE=3 SV=1) HSP 1 Score: 75.1 bits (183), Expect = 3.2e-11 Identity = 35/52 (67.31%), Postives = 40/52 (76.92%), Query Frame = 1
BLAST of CSPI01G11190 vs. TrEMBL
Match: V7BFC0_PHAVU (Uncharacterized protein OS=Phaseolus vulgaris GN=PHAVU_007G049100g PE=3 SV=1) HSP 1 Score: 74.7 bits (182), Expect = 4.2e-11 Identity = 33/49 (67.35%), Postives = 40/49 (81.63%), Query Frame = 1
BLAST of CSPI01G11190 vs. TrEMBL
Match: A0A072VQN6_MEDTR (Cysteine-rich receptor-kinase-like protein OS=Medicago truncatula GN=MTR_1g105840 PE=3 SV=1) HSP 1 Score: 74.7 bits (182), Expect = 4.2e-11 Identity = 32/49 (65.31%), Postives = 42/49 (85.71%), Query Frame = 1
BLAST of CSPI01G11190 vs. TrEMBL
Match: G8A107_MEDTR (Cysteine-rich receptor-like protein kinase OS=Medicago truncatula GN=MTR_116s0027 PE=3 SV=1) HSP 1 Score: 74.7 bits (182), Expect = 4.2e-11 Identity = 32/49 (65.31%), Postives = 42/49 (85.71%), Query Frame = 1
BLAST of CSPI01G11190 vs. TAIR10
Match: AT4G23130.2 (AT4G23130.2 cysteine-rich RLK (RECEPTOR-like protein kinase) 5) HSP 1 Score: 69.3 bits (168), Expect = 8.9e-13 Identity = 33/51 (64.71%), Postives = 39/51 (76.47%), Query Frame = 1
BLAST of CSPI01G11190 vs. TAIR10
Match: AT1G67520.1 (AT1G67520.1 lectin protein kinase family protein) HSP 1 Score: 68.2 bits (165), Expect = 2.0e-12 Identity = 32/47 (68.09%), Postives = 36/47 (76.60%), Query Frame = 1
BLAST of CSPI01G11190 vs. TAIR10
Match: AT4G04510.1 (AT4G04510.1 cysteine-rich RLK (RECEPTOR-like protein kinase) 38) HSP 1 Score: 67.8 bits (164), Expect = 2.6e-12 Identity = 30/49 (61.22%), Postives = 37/49 (75.51%), Query Frame = 1
BLAST of CSPI01G11190 vs. TAIR10
Match: AT4G04570.1 (AT4G04570.1 cysteine-rich RLK (RECEPTOR-like protein kinase) 40) HSP 1 Score: 66.6 bits (161), Expect = 5.8e-12 Identity = 30/49 (61.22%), Postives = 37/49 (75.51%), Query Frame = 1
BLAST of CSPI01G11190 vs. TAIR10
Match: AT4G11470.1 (AT4G11470.1 cysteine-rich RLK (RECEPTOR-like protein kinase) 31) HSP 1 Score: 65.5 bits (158), Expect = 1.3e-11 Identity = 30/49 (61.22%), Postives = 36/49 (73.47%), Query Frame = 1
BLAST of CSPI01G11190 vs. NCBI nr
Match: gi|659068827|ref|XP_008446488.1| (PREDICTED: cysteine-rich receptor-like protein kinase 29 [Cucumis melo]) HSP 1 Score: 104.8 bits (260), Expect = 5.4e-20 Identity = 49/55 (89.09%), Postives = 52/55 (94.55%), Query Frame = 1
BLAST of CSPI01G11190 vs. NCBI nr
Match: gi|659068825|ref|XP_008446476.1| (PREDICTED: cysteine-rich receptor-like protein kinase 28 [Cucumis melo]) HSP 1 Score: 90.9 bits (224), Expect = 8.1e-16 Identity = 42/51 (82.35%), Postives = 45/51 (88.24%), Query Frame = 1
BLAST of CSPI01G11190 vs. NCBI nr
Match: gi|778664887|ref|XP_011648430.1| (PREDICTED: LOW QUALITY PROTEIN: cysteine-rich receptor-like protein kinase 29 [Cucumis sativus]) HSP 1 Score: 87.0 bits (214), Expect = 1.2e-14 Identity = 40/51 (78.43%), Postives = 45/51 (88.24%), Query Frame = 1
BLAST of CSPI01G11190 vs. NCBI nr
Match: gi|659068821|ref|XP_008446448.1| (PREDICTED: cysteine-rich receptor-like protein kinase 26 [Cucumis melo]) HSP 1 Score: 86.7 bits (213), Expect = 1.5e-14 Identity = 38/52 (73.08%), Postives = 47/52 (90.38%), Query Frame = 1
BLAST of CSPI01G11190 vs. NCBI nr
Match: gi|700209477|gb|KGN64573.1| (hypothetical protein Csa_1G065930 [Cucumis sativus]) HSP 1 Score: 76.3 bits (186), Expect = 2.1e-11 Identity = 34/44 (77.27%), Postives = 39/44 (88.64%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (PI183967)
Date Performed: 2017-01-17
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |