CSPI01G07750 (gene) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: five_prime_UTRCDS Hold the cursor over a type above to highlight its positions in the sequence below.CACTCTTCGGGACGGAATGGAAGAAGGGAGGAGATTCTCGAACGAGGAAAAGGATCCAATGACTTCGAAAGAATTGAACGAGGAGCCGTATGAGGTGAAAATCTCACGTACGGTTCTGTCGAGTGGCAGTAAGGGTGACTTATCTGTCAACTTTTCCACTATCACCCCCAAAAAACCAAACTCTGCCTTACGTAAAGTTGCCAAAGTACGCTTAACCTCAAGATTTGAAATCACTGCTTATACGTGGTATTTGGCCATAATTTACAAGAACATTCCTTAATATATATTATAATTTGATACTTTAAAATTAATATTGTAAAAAATACAAAAATTGGGAATGCGGAAAGCGGTGACGAAAAGACAGAGTCCCATTCTTTGAAATGA ATGGAAGAAGGGAGGAGATTCTCGAACGAGGAAAAGGATCCAATGACTTCGAAAGAATTGAACGAGGAGCCGTATGAGGTGAAAATCTCACGTACGGTTCTGTCGAGTGGCAGTAAGGGTGACTTATCTGTCAACTTTTCCACTATCACCCCCAAAAAACCAAACTCTGCCTTACGTAAAGTTGCCAAAGTACGCTTAACCTCAAGATTTGAAATCACTGCTTATACGTGCGGTGACGAAAAGACAGAGTCCCATTCTTTGAAATGA ATGGAAGAAGGGAGGAGATTCTCGAACGAGGAAAAGGATCCAATGACTTCGAAAGAATTGAACGAGGAGCCGTATGAGGTGAAAATCTCACGTACGGTTCTGTCGAGTGGCAGTAAGGGTGACTTATCTGTCAACTTTTCCACTATCACCCCCAAAAAACCAAACTCTGCCTTACGTAAAGTTGCCAAAGTACGCTTAACCTCAAGATTTGAAATCACTGCTTATACGTGCGGTGACGAAAAGACAGAGTCCCATTCTTTGAAATGA
BLAST of CSPI01G07750 vs. Swiss-Prot
Match: RR12B_POPTR (30S ribosomal protein S12-B, chloroplastic OS=Populus trichocarpa GN=rps12-B PE=3 SV=1) HSP 1 Score: 77.8 bits (190), Expect = 6.7e-14 Identity = 42/57 (73.68%), Postives = 47/57 (82.46%), Query Frame = 1
BLAST of CSPI01G07750 vs. Swiss-Prot
Match: RR12B_OLIPU (30S ribosomal protein S12-B, chloroplastic OS=Olimarabidopsis pumila GN=rps12-B PE=3 SV=1) HSP 1 Score: 57.4 bits (137), Expect = 9.4e-08 Identity = 31/50 (62.00%), Postives = 37/50 (74.00%), Query Frame = 1
BLAST of CSPI01G07750 vs. Swiss-Prot
Match: RR12_PINTH (30S ribosomal protein S12, chloroplastic OS=Pinus thunbergii GN=rps12 PE=3 SV=1) HSP 1 Score: 57.4 bits (137), Expect = 9.4e-08 Identity = 30/41 (73.17%), Postives = 33/41 (80.49%), Query Frame = 1
BLAST of CSPI01G07750 vs. Swiss-Prot
Match: RR12_PINKO (30S ribosomal protein S12, chloroplastic OS=Pinus koraiensis GN=rps12 PE=3 SV=2) HSP 1 Score: 57.4 bits (137), Expect = 9.4e-08 Identity = 30/41 (73.17%), Postives = 33/41 (80.49%), Query Frame = 1
BLAST of CSPI01G07750 vs. Swiss-Prot
Match: RR12_SOLBU (30S ribosomal protein S12, chloroplastic OS=Solanum bulbocastanum GN=rps12-A PE=3 SV=1) HSP 1 Score: 55.5 bits (132), Expect = 3.6e-07 Identity = 29/41 (70.73%), Postives = 33/41 (80.49%), Query Frame = 1
BLAST of CSPI01G07750 vs. TrEMBL
Match: A0A0A0LR16_CUCSA (30S ribosomal protein S12-B OS=Cucumis sativus GN=Csa_1G044825 PE=4 SV=1) HSP 1 Score: 141.4 bits (355), Expect = 5.5e-31 Identity = 74/76 (97.37%), Postives = 75/76 (98.68%), Query Frame = 1
BLAST of CSPI01G07750 vs. TrEMBL
Match: U5CU38_AMBTC (Uncharacterized protein OS=Amborella trichopoda GN=AMTR_s02071p00004290 PE=4 SV=1) HSP 1 Score: 111.7 bits (278), Expect = 4.7e-22 Identity = 63/88 (71.59%), Postives = 70/88 (79.55%), Query Frame = 1
BLAST of CSPI01G07750 vs. TrEMBL
Match: A0A0C5G6K8_IPOBA (Ribosomal protein S12 OS=Ipomoea batatas GN=rps12 PE=4 SV=1) HSP 1 Score: 108.2 bits (269), Expect = 5.1e-21 Identity = 59/74 (79.73%), Postives = 62/74 (83.78%), Query Frame = 1
BLAST of CSPI01G07750 vs. TrEMBL
Match: A0A0D2V211_GOSRA (Uncharacterized protein (Fragment) OS=Gossypium raimondii GN=B456_012G049000 PE=4 SV=1) HSP 1 Score: 107.8 bits (268), Expect = 6.7e-21 Identity = 61/88 (69.32%), Postives = 67/88 (76.14%), Query Frame = 1
BLAST of CSPI01G07750 vs. TrEMBL
Match: A0A0D2NAB6_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_005G100800 PE=4 SV=1) HSP 1 Score: 107.5 bits (267), Expect = 8.8e-21 Identity = 62/88 (70.45%), Postives = 66/88 (75.00%), Query Frame = 1
BLAST of CSPI01G07750 vs. TAIR10
Match: ATCG00065.1 (ATCG00065.1 ribosomal protein S12A) HSP 1 Score: 54.7 bits (130), Expect = 3.4e-08 Identity = 29/41 (70.73%), Postives = 32/41 (78.05%), Query Frame = 1
BLAST of CSPI01G07750 vs. TAIR10
Match: ATCG01230.1 (ATCG01230.1 ribosomal protein S12B) HSP 1 Score: 54.7 bits (130), Expect = 3.4e-08 Identity = 29/41 (70.73%), Postives = 32/41 (78.05%), Query Frame = 1
BLAST of CSPI01G07750 vs. TAIR10
Match: ATCG00905.1 (ATCG00905.1 ribosomal protein S12C) HSP 1 Score: 54.7 bits (130), Expect = 3.4e-08 Identity = 29/41 (70.73%), Postives = 32/41 (78.05%), Query Frame = 1
BLAST of CSPI01G07750 vs. NCBI nr
Match: gi|700209137|gb|KGN64233.1| (30S ribosomal protein S12-B [Cucumis sativus]) HSP 1 Score: 141.4 bits (355), Expect = 7.9e-31 Identity = 74/76 (97.37%), Postives = 75/76 (98.68%), Query Frame = 1
BLAST of CSPI01G07750 vs. NCBI nr
Match: gi|548832465|gb|ERM95251.1| (hypothetical protein AMTR_s02071p00004290 [Amborella trichopoda]) HSP 1 Score: 111.7 bits (278), Expect = 6.7e-22 Identity = 63/88 (71.59%), Postives = 70/88 (79.55%), Query Frame = 1
BLAST of CSPI01G07750 vs. NCBI nr
Match: gi|1009172427|ref|XP_015867265.1| (PREDICTED: 30S ribosomal protein S12, chloroplastic-like [Ziziphus jujuba]) HSP 1 Score: 108.6 bits (270), Expect = 5.6e-21 Identity = 58/88 (65.91%), Postives = 68/88 (77.27%), Query Frame = 1
BLAST of CSPI01G07750 vs. NCBI nr
Match: gi|772657602|ref|YP_009128437.1| (ribosomal protein S12 (chloroplast) [Ipomoea batatas]) HSP 1 Score: 108.2 bits (269), Expect = 7.4e-21 Identity = 59/74 (79.73%), Postives = 62/74 (83.78%), Query Frame = 1
BLAST of CSPI01G07750 vs. NCBI nr
Match: gi|763808727|gb|KJB75629.1| (hypothetical protein B456_012G049000, partial [Gossypium raimondii]) HSP 1 Score: 107.8 bits (268), Expect = 9.6e-21 Identity = 61/88 (69.32%), Postives = 67/88 (76.14%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (PI183967)
Date Performed: 2017-01-17
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|