CSPI01G04630 (gene) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGAAAAGAAGAAGAGAGAACATTAAAGAATGTGTTGGAAAGGTGTGTGGAGAGTTAATATGCCCATACCCTCCAGGAATACCAGTAATGATCCCAGGTGAGATTATATCTGAGGAAGCTGTGGATTATCTGTTGCATTTAAAAGGCAAAGTTGCCTCAATTAGCGGTGCATCTGATCCTAAACTATCTTCACTACTTGTCTGCAATGTGTAA ATGAAAAGAAGAAGAGAGAACATTAAAGAATGTGTTGGAAAGGTGTGTGGAGAGTTAATATGCCCATACCCTCCAGGAATACCAGTAATGATCCCAGGTGAGATTATATCTGAGGAAGCTGTGGATTATCTGTTGCATTTAAAAGGCAAAGTTGCCTCAATTAGCGGTGCATCTGATCCTAAACTATCTTCACTACTTGTCTGCAATGTGTAA ATGAAAAGAAGAAGAGAGAACATTAAAGAATGTGTTGGAAAGGTGTGTGGAGAGTTAATATGCCCATACCCTCCAGGAATACCAGTAATGATCCCAGGTGAGATTATATCTGAGGAAGCTGTGGATTATCTGTTGCATTTAAAAGGCAAAGTTGCCTCAATTAGCGGTGCATCTGATCCTAAACTATCTTCACTACTTGTCTGCAATGTGTAA
BLAST of CSPI01G04630 vs. Swiss-Prot
Match: SPEA_BACSU (Arginine decarboxylase OS=Bacillus subtilis (strain 168) GN=speA PE=1 SV=2) HSP 1 Score: 52.8 bits (125), Expect = 1.8e-06 Identity = 23/60 (38.33%), Postives = 33/60 (55.00%), Query Frame = 1
BLAST of CSPI01G04630 vs. TrEMBL
Match: A0A0A0LSC9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G025855 PE=4 SV=1) HSP 1 Score: 141.4 bits (355), Expect = 4.4e-31 Identity = 68/70 (97.14%), Postives = 69/70 (98.57%), Query Frame = 1
BLAST of CSPI01G04630 vs. TrEMBL
Match: A0A0A0LR51_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G424710 PE=4 SV=1) HSP 1 Score: 139.4 bits (350), Expect = 1.7e-30 Identity = 66/70 (94.29%), Postives = 68/70 (97.14%), Query Frame = 1
BLAST of CSPI01G04630 vs. TrEMBL
Match: G7JEX3_MEDTR (Orn/lys/arg decarboxylase OS=Medicago truncatula GN=MTR_4g068230 PE=4 SV=1) HSP 1 Score: 107.5 bits (267), Expect = 7.0e-21 Identity = 48/68 (70.59%), Postives = 59/68 (86.76%), Query Frame = 1
BLAST of CSPI01G04630 vs. TrEMBL
Match: B7FJL6_MEDTR (Putative uncharacterized protein OS=Medicago truncatula PE=2 SV=1) HSP 1 Score: 107.5 bits (267), Expect = 7.0e-21 Identity = 48/68 (70.59%), Postives = 59/68 (86.76%), Query Frame = 1
BLAST of CSPI01G04630 vs. TrEMBL
Match: G7JEX4_MEDTR (Orn/lys/arg decarboxylase major region protein OS=Medicago truncatula GN=MTR_4g068240 PE=4 SV=2) HSP 1 Score: 107.1 bits (266), Expect = 9.1e-21 Identity = 47/68 (69.12%), Postives = 60/68 (88.24%), Query Frame = 1
BLAST of CSPI01G04630 vs. NCBI nr
Match: gi|700208808|gb|KGN63904.1| (hypothetical protein Csa_1G025855 [Cucumis sativus]) HSP 1 Score: 141.4 bits (355), Expect = 6.3e-31 Identity = 68/70 (97.14%), Postives = 69/70 (98.57%), Query Frame = 1
BLAST of CSPI01G04630 vs. NCBI nr
Match: gi|778673595|ref|XP_011650023.1| (PREDICTED: uncharacterized protein LOC101211215 [Cucumis sativus]) HSP 1 Score: 139.4 bits (350), Expect = 2.4e-30 Identity = 66/70 (94.29%), Postives = 68/70 (97.14%), Query Frame = 1
BLAST of CSPI01G04630 vs. NCBI nr
Match: gi|659111914|ref|XP_008455970.1| (PREDICTED: uncharacterized protein LOC103496033 [Cucumis melo]) HSP 1 Score: 138.3 bits (347), Expect = 5.3e-30 Identity = 65/69 (94.20%), Postives = 67/69 (97.10%), Query Frame = 1
BLAST of CSPI01G04630 vs. NCBI nr
Match: gi|659107476|ref|XP_008453693.1| (PREDICTED: LOW QUALITY PROTEIN: uncharacterized protein LOC103494341 [Cucumis melo]) HSP 1 Score: 129.0 bits (323), Expect = 3.2e-27 Identity = 62/69 (89.86%), Postives = 64/69 (92.75%), Query Frame = 1
BLAST of CSPI01G04630 vs. NCBI nr
Match: gi|217073172|gb|ACJ84945.1| (unknown [Medicago truncatula]) HSP 1 Score: 107.5 bits (267), Expect = 1.0e-20 Identity = 48/68 (70.59%), Postives = 59/68 (86.76%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (PI183967)
Date Performed: 2017-01-17
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|