Bhi07G001471 (gene) Wax gourd
The following sequences are available for this feature:
Legend: polypeptideCDSexon Hold the cursor over a type above to highlight its positions in the sequence below.ATGGAATCCCCAAAGCAGGAGTATGTAAAACAATCATGGAGTTCAGGTTTGAGTTTGAAGCTTCAATGGTTCGGGTAAATCTACTGTTGTCGGACTGATCGAAAGATTTTACGATCCTCAAAATGGTGCAGTCCTCATTGATGGAATAGACATCAAGAGCTATAATTTTAGAAGTTTGAGGTCACACATTGCTCTAGTGAGTCAAGAACCCGCACTTCTCACAGGAACTATACGCAAGAAGATACTATCTGGGCAAGACGAACGTTCAGAAAACGAAATTAAGAAGGCTGCAAAACTTGCCAATGCTCATGAGTTCATTAGGTAA ATGGAATCCCCAAAGCAGGAGTATGTAAAACAATCATGGAGTTCAGGTTTGAGTTTGAAGCTTCAATGGTTCGGATTTTACGATCCTCAAAATGGTGCAGTCCTCATTGATGGAATAGACATCAAGAGCTATAATTTTAGAAGTTTGAGGTCACACATTGCTCTAGTGAGTCAAGAACCCGCACTTCTCACAGGAACTATACGCAAGAAGATACTATCTGGGCAAGACGAACGTTCAGAAAACGAAATTAAGAAGGCTGCAAAACTTGCCAATGCTCATGAGTTCATTAGGTAA ATGGAATCCCCAAAGCAGGAGTATGTAAAACAATCATGGAGTTCAGGTTTGAGTTTGAAGCTTCAATGGTTCGGATTTTACGATCCTCAAAATGGTGCAGTCCTCATTGATGGAATAGACATCAAGAGCTATAATTTTAGAAGTTTGAGGTCACACATTGCTCTAGTGAGTCAAGAACCCGCACTTCTCACAGGAACTATACGCAAGAAGATACTATCTGGGCAAGACGAACGTTCAGAAAACGAAATTAAGAAGGCTGCAAAACTTGCCAATGCTCATGAGTTCATTAGGTAA MESPKQEYVKQSWSSGLSLKLQWFGFYDPQNGAVLIDGIDIKSYNFRSLRSHIALVSQEPALLTGTIRKKILSGQDERSENEIKKAAKLANAHEFIR
BLAST of Bhi07G001471 vs. Swiss-Prot
Match: sp|Q6YUU5|MDR_ORYSJ (Putative multidrug resistance protein OS=Oryza sativa subsp. japonica OX=39947 GN=Os02g0190300 PE=3 SV=1) HSP 1 Score: 89.4 bits (220), Expect = 2.5e-17 Identity = 44/71 (61.97%), Postives = 53/71 (74.65%), Query Frame = 0
BLAST of Bhi07G001471 vs. Swiss-Prot
Match: sp|Q9LHD1|AB15B_ARATH (ABC transporter B family member 15 OS=Arabidopsis thaliana OX=3702 GN=ABCB15 PE=3 SV=1) HSP 1 Score: 86.3 bits (212), Expect = 2.1e-16 Identity = 46/73 (63.01%), Postives = 53/73 (72.60%), Query Frame = 0
BLAST of Bhi07G001471 vs. Swiss-Prot
Match: sp|Q9LSJ2|AB22B_ARATH (ABC transporter B family member 22 OS=Arabidopsis thaliana OX=3702 GN=ABCB22 PE=3 SV=2) HSP 1 Score: 85.9 bits (211), Expect = 2.7e-16 Identity = 45/73 (61.64%), Postives = 53/73 (72.60%), Query Frame = 0
BLAST of Bhi07G001471 vs. Swiss-Prot
Match: sp|Q9SGY1|AB10B_ARATH (ABC transporter B family member 10 OS=Arabidopsis thaliana OX=3702 GN=ABCB10 PE=1 SV=2) HSP 1 Score: 85.5 bits (210), Expect = 3.6e-16 Identity = 47/83 (56.63%), Postives = 57/83 (68.67%), Query Frame = 0
BLAST of Bhi07G001471 vs. Swiss-Prot
Match: sp|Q9LSJ6|AB17B_ARATH (ABC transporter B family member 17 OS=Arabidopsis thaliana OX=3702 GN=ABCB17 PE=3 SV=1) HSP 1 Score: 84.3 bits (207), Expect = 7.9e-16 Identity = 44/73 (60.27%), Postives = 54/73 (73.97%), Query Frame = 0
BLAST of Bhi07G001471 vs. TAIR10
Match: AT3G28345.1 (ABC transporter family protein) HSP 1 Score: 86.3 bits (212), Expect = 1.2e-17 Identity = 46/73 (63.01%), Postives = 53/73 (72.60%), Query Frame = 0
BLAST of Bhi07G001471 vs. TAIR10
Match: AT3G28415.1 (ABC transporter family protein) HSP 1 Score: 85.9 bits (211), Expect = 1.5e-17 Identity = 45/73 (61.64%), Postives = 53/73 (72.60%), Query Frame = 0
BLAST of Bhi07G001471 vs. TAIR10
Match: AT1G10680.1 (P-glycoprotein 10) HSP 1 Score: 85.5 bits (210), Expect = 2.0e-17 Identity = 47/83 (56.63%), Postives = 57/83 (68.67%), Query Frame = 0
BLAST of Bhi07G001471 vs. TAIR10
Match: AT3G28380.1 (P-glycoprotein 17) HSP 1 Score: 84.3 bits (207), Expect = 4.4e-17 Identity = 44/73 (60.27%), Postives = 54/73 (73.97%), Query Frame = 0
BLAST of Bhi07G001471 vs. TAIR10
Match: AT1G27940.1 (P-glycoprotein 13) HSP 1 Score: 83.6 bits (205), Expect = 7.5e-17 Identity = 43/71 (60.56%), Postives = 50/71 (70.42%), Query Frame = 0
BLAST of Bhi07G001471 vs. TrEMBL
Match: tr|A0A0A0KQ07|A0A0A0KQ07_CUCSA (Uncharacterized protein OS=Cucumis sativus OX=3659 GN=Csa_5G593380 PE=4 SV=1) HSP 1 Score: 119.0 bits (297), Expect = 5.9e-24 Identity = 59/71 (83.10%), Postives = 62/71 (87.32%), Query Frame = 0
BLAST of Bhi07G001471 vs. TrEMBL
Match: tr|A0A1S3BEB7|A0A1S3BEB7_CUCME (putative multidrug resistance protein OS=Cucumis melo OX=3656 GN=LOC103488944 PE=4 SV=1) HSP 1 Score: 113.6 bits (283), Expect = 2.5e-22 Identity = 55/71 (77.46%), Postives = 61/71 (85.92%), Query Frame = 0
BLAST of Bhi07G001471 vs. TrEMBL
Match: tr|A0A2U1LUI1|A0A2U1LUI1_ARTAN (AAA+ ATPase domain-containing protein OS=Artemisia annua OX=35608 GN=CTI12_AA452560 PE=4 SV=1) HSP 1 Score: 105.9 bits (263), Expect = 5.1e-20 Identity = 52/71 (73.24%), Postives = 58/71 (81.69%), Query Frame = 0
BLAST of Bhi07G001471 vs. TrEMBL
Match: tr|A0A0D2Q8R0|A0A0D2Q8R0_GOSRA (Uncharacterized protein OS=Gossypium raimondii OX=29730 GN=B456_002G188900 PE=4 SV=1) HSP 1 Score: 101.7 bits (252), Expect = 9.7e-19 Identity = 50/71 (70.42%), Postives = 57/71 (80.28%), Query Frame = 0
BLAST of Bhi07G001471 vs. TrEMBL
Match: tr|A0A1R3GQH4|A0A1R3GQH4_COCAP (Uncharacterized protein OS=Corchorus capsularis OX=210143 GN=CCACVL1_24246 PE=4 SV=1) HSP 1 Score: 100.9 bits (250), Expect = 1.7e-18 Identity = 49/72 (68.06%), Postives = 59/72 (81.94%), Query Frame = 0
BLAST of Bhi07G001471 vs. NCBI nr
Match: XP_004135503.1 (PREDICTED: ABC transporter B family member 15-like [Cucumis sativus]) HSP 1 Score: 119.0 bits (297), Expect = 8.9e-24 Identity = 59/71 (83.10%), Postives = 62/71 (87.32%), Query Frame = 0
BLAST of Bhi07G001471 vs. NCBI nr
Match: KGN51725.1 (hypothetical protein Csa_5G593380 [Cucumis sativus]) HSP 1 Score: 119.0 bits (297), Expect = 8.9e-24 Identity = 59/71 (83.10%), Postives = 62/71 (87.32%), Query Frame = 0
BLAST of Bhi07G001471 vs. NCBI nr
Match: XP_008446126.1 (PREDICTED: putative multidrug resistance protein [Cucumis melo]) HSP 1 Score: 113.6 bits (283), Expect = 3.7e-22 Identity = 55/71 (77.46%), Postives = 61/71 (85.92%), Query Frame = 0
BLAST of Bhi07G001471 vs. NCBI nr
Match: XP_022151783.1 (ABC transporter B family member 15-like [Momordica charantia]) HSP 1 Score: 112.1 bits (279), Expect = 1.1e-21 Identity = 56/71 (78.87%), Postives = 60/71 (84.51%), Query Frame = 0
BLAST of Bhi07G001471 vs. NCBI nr
Match: PWA52634.1 (AAA+ ATPase domain-containing protein [Artemisia annua]) HSP 1 Score: 105.9 bits (263), Expect = 7.8e-20 Identity = 52/71 (73.24%), Postives = 58/71 (81.69%), Query Frame = 0
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of wax gourd
Date Performed: 2019-11-17
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|