Bhi06G000832 (gene) Wax gourd
The following sequences are available for this feature:
Legend: polypeptideexonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGACAAGCACTTGAGCATTTTGGCAAAGCAACATATTGAGACATGTTTTGTAAAAATTAATACTGAGAAAAGTCCATTTCTGGCTGAGAAGTTGAAGATCGTTGTTCTTCCAACCCTTGCTCTGATCAAGAATGCAAAAGTAGATGACCATGTGGTATGTCCTTTATGATAATACACCATTGATTACTGAATTATGGTTGTTTTTATTAACATTACCTTTCTCTCATGTGAATCCATCAGGTAGGATTTGATGAGCTTGGTGAAATTGACGAATTCAGCACAGAGGAATTGGAAGATAGATTGGAAAAATGTCAAGTCATCCATGAAGGTGAATCATCCATAAATGCTTCAAAATCTAGTGCACAAACCAGGAGAAGTATACGACAAAGTACGAGATCAGACTTATCAGATTCAGAATAA ATGGACAAGCACTTGAGCATTTTGGCAAAGCAACATATTGAGACATGTTTTGTAAAAATTAATACTGAGAAAAGTCCATTTCTGGCTGAGAAGTTGAAGATCGTTGTTCTTCCAACCCTTGCTCTGATCAAGAATGCAAAAGTAGATGACCATGTGGTAGGATTTGATGAGCTTGGTGAAATTGACGAATTCAGCACAGAGGAATTGGAAGATAGATTGGAAAAATGTCAAGTCATCCATGAAGGTGAATCATCCATAAATGCTTCAAAATCTAGTGCACAAACCAGGAGAAGTATACGACAAAGTACGAGATCAGACTTATCAGATTCAGAATAA ATGGACAAGCACTTGAGCATTTTGGCAAAGCAACATATTGAGACATGTTTTGTAAAAATTAATACTGAGAAAAGTCCATTTCTGGCTGAGAAGTTGAAGATCGTTGTTCTTCCAACCCTTGCTCTGATCAAGAATGCAAAAGTAGATGACCATGTGGTAGGATTTGATGAGCTTGGTGAAATTGACGAATTCAGCACAGAGGAATTGGAAGATAGATTGGAAAAATGTCAAGTCATCCATGAAGGTGAATCATCCATAAATGCTTCAAAATCTAGTGCACAAACCAGGAGAAGTATACGACAAAGTACGAGATCAGACTTATCAGATTCAGAATAA MDKHLSILAKQHIETCFVKINTEKSPFLAEKLKIVVLPTLALIKNAKVDDHVVGFDELGEIDEFSTEELEDRLEKCQVIHEGESSINASKSSAQTRRSIRQSTRSDLSDSE
BLAST of Bhi06G000832 vs. Swiss-Prot
Match: sp|O64628|TXND9_ARATH (Thioredoxin domain-containing protein 9 homolog OS=Arabidopsis thaliana OX=3702 GN=At2g18990 PE=2 SV=1) HSP 1 Score: 145.2 bits (365), Expect = 4.3e-34 Identity = 82/112 (73.21%), Postives = 95/112 (84.82%), Query Frame = 0
BLAST of Bhi06G000832 vs. Swiss-Prot
Match: sp|Q9CQ79|TXND9_MOUSE (Thioredoxin domain-containing protein 9 OS=Mus musculus OX=10090 GN=Txndc9 PE=1 SV=1) HSP 1 Score: 95.1 bits (235), Expect = 5.1e-19 Identity = 45/80 (56.25%), Postives = 64/80 (80.00%), Query Frame = 0
BLAST of Bhi06G000832 vs. Swiss-Prot
Match: sp|O14530|TXND9_HUMAN (Thioredoxin domain-containing protein 9 OS=Homo sapiens OX=9606 GN=TXNDC9 PE=1 SV=2) HSP 1 Score: 94.0 bits (232), Expect = 1.1e-18 Identity = 43/80 (53.75%), Postives = 63/80 (78.75%), Query Frame = 0
BLAST of Bhi06G000832 vs. Swiss-Prot
Match: sp|O18883|TXND9_BOVIN (Thioredoxin domain-containing protein 9 OS=Bos taurus OX=9913 GN=TXNDC9 PE=2 SV=2) HSP 1 Score: 92.8 bits (229), Expect = 2.5e-18 Identity = 43/73 (58.90%), Postives = 59/73 (80.82%), Query Frame = 0
BLAST of Bhi06G000832 vs. Swiss-Prot
Match: sp|Q8K581|TXND9_RAT (Thioredoxin domain-containing protein 9 OS=Rattus norvegicus OX=10116 GN=Txndc9 PE=2 SV=2) HSP 1 Score: 92.8 bits (229), Expect = 2.5e-18 Identity = 44/80 (55.00%), Postives = 63/80 (78.75%), Query Frame = 0
BLAST of Bhi06G000832 vs. TAIR10
Match: AT2G18990.1 (thioredoxin domain-containing protein 9 homolog) HSP 1 Score: 145.2 bits (365), Expect = 2.4e-35 Identity = 82/112 (73.21%), Postives = 95/112 (84.82%), Query Frame = 0
BLAST of Bhi06G000832 vs. TAIR10
Match: AT3G25580.1 (Thioredoxin superfamily protein) HSP 1 Score: 145.2 bits (365), Expect = 2.4e-35 Identity = 83/112 (74.11%), Postives = 96/112 (85.71%), Query Frame = 0
BLAST of Bhi06G000832 vs. TAIR10
Match: AT5G66410.1 (phosducin-like protein 3 homolog) HSP 1 Score: 68.6 bits (166), Expect = 2.9e-12 Identity = 45/113 (39.82%), Postives = 63/113 (55.75%), Query Frame = 0
BLAST of Bhi06G000832 vs. TAIR10
Match: AT3G50960.1 (phosducin-like protein 3 homolog) HSP 1 Score: 64.3 bits (155), Expect = 5.4e-11 Identity = 43/113 (38.05%), Postives = 59/113 (52.21%), Query Frame = 0
BLAST of Bhi06G000832 vs. TrEMBL
Match: tr|A0A1S3C206|A0A1S3C206_CUCME (thioredoxin domain-containing protein 9 homolog OS=Cucumis melo OX=3656 GN=LOC103495950 PE=4 SV=1) HSP 1 Score: 184.1 bits (466), Expect = 1.7e-43 Identity = 102/112 (91.07%), Postives = 104/112 (92.86%), Query Frame = 0
BLAST of Bhi06G000832 vs. TrEMBL
Match: tr|A0A0A0LT99|A0A0A0LT99_CUCSA (Uncharacterized protein OS=Cucumis sativus OX=3659 GN=Csa_2G418960 PE=4 SV=1) HSP 1 Score: 184.1 bits (466), Expect = 1.7e-43 Identity = 102/112 (91.07%), Postives = 104/112 (92.86%), Query Frame = 0
BLAST of Bhi06G000832 vs. TrEMBL
Match: tr|A0A2P5EYL3|A0A2P5EYL3_9ROSA (Thioredoxin domain-containing protein OS=Trema orientalis OX=63057 GN=TorRG33x02_136670 PE=4 SV=1) HSP 1 Score: 164.1 bits (414), Expect = 1.8e-37 Identity = 92/112 (82.14%), Postives = 100/112 (89.29%), Query Frame = 0
BLAST of Bhi06G000832 vs. TrEMBL
Match: tr|I1LEH0|I1LEH0_SOYBN (Uncharacterized protein OS=Glycine max OX=3847 GN=100814116 PE=4 SV=1) HSP 1 Score: 163.7 bits (413), Expect = 2.4e-37 Identity = 90/112 (80.36%), Postives = 101/112 (90.18%), Query Frame = 0
BLAST of Bhi06G000832 vs. TrEMBL
Match: tr|I1NG02|I1NG02_SOYBN (Uncharacterized protein OS=Glycine max OX=3847 GN=100812734 PE=4 SV=1) HSP 1 Score: 162.2 bits (409), Expect = 6.9e-37 Identity = 89/112 (79.46%), Postives = 100/112 (89.29%), Query Frame = 0
BLAST of Bhi06G000832 vs. NCBI nr
Match: XP_011650010.1 (PREDICTED: thioredoxin domain-containing protein 9 homolog [Cucumis sativus] >KGN63261.1 hypothetical protein Csa_2G418960 [Cucumis sativus]) HSP 1 Score: 184.1 bits (466), Expect = 2.6e-43 Identity = 102/112 (91.07%), Postives = 104/112 (92.86%), Query Frame = 0
BLAST of Bhi06G000832 vs. NCBI nr
Match: XP_008455854.1 (PREDICTED: thioredoxin domain-containing protein 9 homolog [Cucumis melo] >XP_008455855.1 PREDICTED: thioredoxin domain-containing protein 9 homolog [Cucumis melo]) HSP 1 Score: 184.1 bits (466), Expect = 2.6e-43 Identity = 102/112 (91.07%), Postives = 104/112 (92.86%), Query Frame = 0
BLAST of Bhi06G000832 vs. NCBI nr
Match: XP_022944636.1 (thioredoxin domain-containing protein 9 homolog [Cucurbita moschata] >XP_022944637.1 thioredoxin domain-containing protein 9 homolog [Cucurbita moschata] >XP_022944638.1 thioredoxin domain-containing protein 9 homolog [Cucurbita moschata] >XP_022986377.1 thioredoxin domain-containing protein 9 homolog [Cucurbita maxima] >XP_022986378.1 thioredoxin domain-containing protein 9 homolog [Cucurbita maxima] >XP_022986379.1 thioredoxin domain-containing protein 9 homolog [Cucurbita maxima] >XP_022986380.1 thioredoxin domain-containing protein 9 homolog [Cucurbita maxima] >XP_022986381.1 thioredoxin domain-containing protein 9 homolog [Cucurbita maxima]) HSP 1 Score: 179.1 bits (453), Expect = 8.3e-42 Identity = 99/112 (88.39%), Postives = 104/112 (92.86%), Query Frame = 0
BLAST of Bhi06G000832 vs. NCBI nr
Match: XP_023513333.1 (thioredoxin domain-containing protein 9 homolog [Cucurbita pepo subsp. pepo] >XP_023513334.1 thioredoxin domain-containing protein 9 homolog [Cucurbita pepo subsp. pepo] >XP_023513335.1 thioredoxin domain-containing protein 9 homolog [Cucurbita pepo subsp. pepo]) HSP 1 Score: 177.9 bits (450), Expect = 1.8e-41 Identity = 98/112 (87.50%), Postives = 104/112 (92.86%), Query Frame = 0
BLAST of Bhi06G000832 vs. NCBI nr
Match: XP_023000391.1 (thioredoxin domain-containing protein 9 homolog [Cucurbita maxima]) HSP 1 Score: 173.7 bits (439), Expect = 3.5e-40 Identity = 94/112 (83.93%), Postives = 103/112 (91.96%), Query Frame = 0
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of wax gourd
Date Performed: 2019-11-17
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|