WMU13141 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
TGTGAAATCTATGCATCTTGTGAGCCCTGTCCGATGTGCTTTTGGCGCCATCCATCTTTCAAGAATTAAAGAGATTGGTTTATGGAGCCGAAGCAGAAGCTGCAATTGCAGTAGGATTTGATGATTTCATTGCTGATGCCATTAGGGGCACTGGGTTTTATCAGAAAGCTTCATTTGGAAATCAAGAAAGCAGATGGGAATGGTGCTGTCATTGCTGAGCAAGTATTTGAGAAAACAAAGGAAAAATTTACAATTGTATTGAATAATTATCCTTTTCTTTTCTTTTTCTTTTTTCTTTTTCCTTGTTAAAATAATAATATCAAATGTTCATTACATCTAATTCATGGAACATCATGTAGTTGTAGCTTT
BLAST of WMU13141 vs. TAIR10
Match: AT5G28050.2 (AT5G28050.2 Cytidine/deoxycytidylate deaminase family protein) HSP 1 Score: 71.6 bits (174), Expect = 3.7e-13 Identity = 43/86 (50.00%), Postives = 50/86 (58.14%), Query Frame = 1
BLAST of WMU13141 vs. TAIR10
Match: AT3G05300.1 (AT3G05300.1 Cytidine/deoxycytidylate deaminase family protein) HSP 1 Score: 49.7 bits (117), Expect = 1.5e-06 Identity = 34/85 (40.00%), Postives = 40/85 (47.06%), Query Frame = 1
BLAST of WMU13141 vs. TrEMBL
Match: U7E295_POPTR (Cytidine/deoxycytidylate deaminase family protein OS=Populus trichocarpa GN=POPTR_0030s00460g PE=4 SV=1) HSP 1 Score: 82.4 bits (202), Expect = 4.2e-13 Identity = 48/86 (55.81%), Postives = 56/86 (65.12%), Query Frame = 1
BLAST of WMU13141 vs. TrEMBL
Match: B9MZH3_POPTR (Cytidine/deoxycytidylate deaminase family protein OS=Populus trichocarpa GN=POPTR_0005s05110g PE=4 SV=1) HSP 1 Score: 82.0 bits (201), Expect = 5.5e-13 Identity = 48/86 (55.81%), Postives = 56/86 (65.12%), Query Frame = 1
BLAST of WMU13141 vs. TrEMBL
Match: A0A0A0LZ82_CUCSA (Guanine deaminase OS=Cucumis sativus GN=Csa_1G574840 PE=4 SV=1) HSP 1 Score: 81.3 bits (199), Expect = 9.3e-13 Identity = 47/86 (54.65%), Postives = 56/86 (65.12%), Query Frame = 1
BLAST of WMU13141 vs. TrEMBL
Match: M0SHG9_MUSAM (Uncharacterized protein OS=Musa acuminata subsp. malaccensis PE=4 SV=1) HSP 1 Score: 80.9 bits (198), Expect = 1.2e-12 Identity = 46/84 (54.76%), Postives = 55/84 (65.48%), Query Frame = 1
BLAST of WMU13141 vs. TrEMBL
Match: A0A0S3SQ64_PHAAN (Uncharacterized protein OS=Vigna angularis var. angularis GN=Vigan.08G164600 PE=4 SV=1) HSP 1 Score: 79.7 bits (195), Expect = 2.7e-12 Identity = 47/86 (54.65%), Postives = 56/86 (65.12%), Query Frame = 1
BLAST of WMU13141 vs. NCBI nr
Match: gi|743866462|ref|XP_011032473.1| (PREDICTED: probable cytosine deaminase [Populus euphratica]) HSP 1 Score: 86.3 bits (212), Expect = 4.1e-14 Identity = 48/86 (55.81%), Postives = 57/86 (66.28%), Query Frame = 1
BLAST of WMU13141 vs. NCBI nr
Match: gi|566259532|ref|XP_006389324.1| (cytidine/deoxycytidylate deaminase family protein [Populus trichocarpa]) HSP 1 Score: 85.5 bits (210), Expect = 7.1e-14 Identity = 48/86 (55.81%), Postives = 56/86 (65.12%), Query Frame = 1
BLAST of WMU13141 vs. NCBI nr
Match: gi|743923196|ref|XP_011005682.1| (PREDICTED: tRNA(adenine(34)) deaminase, chloroplastic-like isoform X3 [Populus euphratica]) HSP 1 Score: 85.5 bits (210), Expect = 7.1e-14 Identity = 48/86 (55.81%), Postives = 56/86 (65.12%), Query Frame = 1
BLAST of WMU13141 vs. NCBI nr
Match: gi|743923194|ref|XP_011005681.1| (PREDICTED: tRNA(adenine(34)) deaminase, chloroplastic-like isoform X2 [Populus euphratica]) HSP 1 Score: 85.5 bits (210), Expect = 7.1e-14 Identity = 48/86 (55.81%), Postives = 56/86 (65.12%), Query Frame = 1
BLAST of WMU13141 vs. NCBI nr
Match: gi|743923192|ref|XP_011005680.1| (PREDICTED: tRNA(adenine(34)) deaminase, chloroplastic-like isoform X1 [Populus euphratica]) HSP 1 Score: 85.5 bits (210), Expect = 7.1e-14 Identity = 48/86 (55.81%), Postives = 56/86 (65.12%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|